OUT OF MIND
Would you like to react to this message? Create an account in a few clicks or log in to continue.
Latest topics
» Who made these circles in the Sahara?
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyToday at 11:55 am by PurpleSkyz

» Military Shows New UFO Videos to Congress
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyToday at 11:50 am by PurpleSkyz

» Why Human DNA Might Be The Product of Another Intelligence
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyToday at 10:41 am by PurpleSkyz

» 5G Health Effects Testimony to Mitchell South Dakota Council May 2022
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyToday at 10:30 am by PurpleSkyz

» The Ghostly Sounds of Auroras Can Be Heard, Even When They're Invisible
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyToday at 9:34 am by PurpleSkyz

» RFK, Jr. to Speak at May 19 ‘Humanity Against Censorship’ Rally
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyToday at 9:28 am by PurpleSkyz

» Biden Health Secretary Says He Knew About Baby Formula Crisis Last Year
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyToday at 9:15 am by PurpleSkyz

» Rheumatologist: 40% of my 3,000 vaxxed patients reported injury
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyToday at 9:10 am by PurpleSkyz

»  The Journey to #OceanStewardship - Natreve x Plastic Bank
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyToday at 1:04 am by PurpleSkyz

»  Baby formula factory Abbott and FDA reach agreement to restart production
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyToday at 12:56 am by PurpleSkyz

» Do you know someone who died between Mar and December 2020?
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyToday at 12:44 am by PurpleSkyz

» 2000 Felons and Zero Justice
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyYesterday at 9:33 am by PurpleSkyz

» Rhonda Wilson – Why Are Vaccinated People Emitting MAC Addresses?
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyYesterday at 8:21 am by PurpleSkyz

» These 20 States Threaten Legal Action Over the Ministry of Truth
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyYesterday at 8:17 am by PurpleSkyz

» Global COVID Summit Declaration Representing 17,000 Physicians and Medical Scientists
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyYesterday at 7:58 am by PurpleSkyz

» Obama claims people are “dying from disinformation” … which is TRUE for those who took the clot shots after believing pharma industry lies
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyYesterday at 12:29 am by PurpleSkyz

» Just Wow! 3D-Printed Homes Cut Construction Time From 4 Weeks to Only 28 Hours
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyYesterday at 12:21 am by PurpleSkyz

» Playing Video Games Has an Unexpected Effect on Kids' IQ, Says New Study
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyYesterday at 12:16 am by PurpleSkyz

» Population decline is already solving the apparent ‘climate crisis’ - Thanks CV and CV Vax!
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyYesterday at 12:12 am by PurpleSkyz

» Synthetic Biology: The $3.6 Trillion Science Changing Life As We Know It
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyYesterday at 12:07 am by PurpleSkyz

» Wisconsin fox kits test positive for highly pathogenic avian influenza
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyYesterday at 12:05 am by PurpleSkyz

» Alan Watts ~ It All Starts With You
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA EmptyYesterday at 12:02 am by PurpleSkyz

You are not connected. Please login or register

OUT OF MIND » BREAKING NEWS & HOT TOPICS » COVID-19 » Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA

Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA

Go down  Message [Page 1 of 1]

PurpleSkyz

PurpleSkyz
Admin

Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA 354x202xPfizer.jpg.pagespeed.ic.R4A8e-vAdL


Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA

The COVID World post date: February 27th, 2022
By Igor Chudov

A new study is out: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.


Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA 622x205xdsasdas.jpg.pagespeed.ic.DRtHYt2zeK

What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of the Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.

It was not supposed to happen

For over a year, our trusted “heath experts and fact-checkers” kept telling us the opposite:

Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA 525x496xasddsad.jpg.pagespeed.ic.EZZ3VPd8Jd

Details

Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA 688x302xdsadsdsa.jpg.pagespeed.ic.hS08Rc5-YM

What the article shows is that in vitro, using a human liver cell line, the Pfizer mRNA vaccine uses a natural reverse transcriptase enzyme called LINE-1, and the genetic code of the vaccine is reverse transcribed into the DNA.
It also explains that vaccine mRNA actually does travel to the liver as one of the preferred sites (the other sites, as we heard, are ovaries and more).
What does this mean? Normally, our cells do the opposite: the cell nucleus, where the DNA is, expresses certain DNA code based on conditions of the cell and produces natural, human messenger RNA. That messenger RNA travels out of the nucleus, where it is expressed into proteins needed for cell building. This is how growing organisms express different genetic programs to grow muscle cells or brain cells, etc.
This process is called “transcription”.
For many years, Central Dogma of Molecular Biology stated that the “reverse transcription” — moving genetic code from RNA back into the sacred cellular nucleus and recoding the DNA — was impossible. Eventually, scientists realized that it is possible under various conditions. For example, the HIV RNA virus is able to do so and it reprograms our DNA to produce copies of it. HIV is the virus that causes AIDS.
To effect reverse transcription, enzymes called “reverse transcriptases” are needed. One of them is called LINE-1.
Apparently, per the study, the Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme.

Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA 519x531xdsasdsa.jpg.pagespeed.ic.dOP-SJgrVH

After seeing LINE-1 reverse transcriptase rise, they tested for alterations to the DNA, making sure they are not picking up the RNA instead.
Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA 582x460xdsadssad.jpg.pagespeed.ic.8wPUoEauvv

The genetic code that they picked up is:
Code:
CGAGGTGGCCAAGAATCTGAACGAGA
Code:
GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA
Code:
TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT
Code:
GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT
Code:
TCGACGAGGACGATTCTGAGCCCGTGCTGA
Code:
AGGGCGTGAAACTGCACTACACATGATGAC
Code:
TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA
Code:
GTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCT
Code:
CTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA
Does anyone want to run BLAST on it?

Simplified

Let me explain:
The Pfizer mRNA vaccine changes our genetic code that determines how our organisms operate, that you inherited from your mom and dad. Now your DNA was changed from what your mom and dad gave you, by adding a little mysterious “edit” from Pfizer.
Your organism acts in accordance with your DNA program, and now, well, the program has been hacked and modified by Pfizer.

Cancer Code

Considering that Sars-Cov-2 “spike protein” has a cancer code from Moderna’s 2017 patent 9,587,003, it is imperative to find out the implications of this reverse transcription, and whether the vaccinated now have any undesirable genetic code embedded into their DNA.
Of particular interest is whether this mRNA-induced reverse transcription affects the “germ-line”, such as eggs and sperm cells, and whether it also affects the fetus of pregnant mothers.
Here is an anonymous 4chan post from Dec. 2020, long before any of this became known. The date makes us all ask, did this person know too much?

Worst Fears Realized: Pfizer mRNA Integrates Into Your DNA 639x416xhttps___bucketeer-e05bbc84-baa3-437e-9518-adb32be77984-1-1024x667.jpg.pagespeed.ic.2b0xfSH4py


Please repost this article far and wide due to its big implication for our public health.


https://thecovidworld.com/worst-fears-realized-pfizer-mrna-integrates-into-your-dna/
Thanks to: https://thecovidworld.com



  

Back to top  Message [Page 1 of 1]

Permissions in this forum:
You cannot reply to topics in this forum